Interleukin-2 Can Rescue T cell Activation and Proliferation in CARMIL2-deficient Patients

עודד שמריז ^1,10 Amos J. Simon ^2,3 Atar Lev ^2,3 Orli Megged ⁴ Oren Ledder ⁵ Elie Picard ⁶ Josef Leon ⁶ Vered Molcho-Peassach ⁷ Yuval Tal ¹ Peri Millman ⁸ Mordechai Slae ⁸ Raz Somech ^3,9 Michael Berger ¹⁰ Ori Toker ¹¹

¹Clinical Immunology and Allergy, Hadassah-Hebrew University Medical Center, ישראל
²Sheba Cancer Research Center and Institute of Hematology, Sheba Medical Center, Tel Hashomer, ישראל
³Sackler Faculty of Medicine, Tel Aviv University, ישראל
⁴Pediatric Infectious Diseases Unit, Shaare Zedek Medical Center, ישראל
⁵Juliet Keidan Institute of Paediatric Gastroenterology and Nutrition, Shaare Zedek Medical Center, ישראל
⁶Pediatric Pulmonology Unit, Shaare Zedek Medical Center, ישראל
⁷Department of Dermatology, Hadassah-Hebrew University Medical Center, ישראל
⁸Pediatric Gastroenterology Unit, Hadassah-Hebrew University Medical Center, ישראל
⁹Pediatric Department a and Immunology Service, Jeffrey Modell Foundation Center, Edmond and Lily Safra Children's Hospital, Sheba Medical Center, ישראל
¹⁰The Lautenberg Center for Immunology and Cancer Research, Institute of Medical Research Israel-Canada, Hebrew University-Hadassah Medical School, ישראל
¹¹Allergy Clinical Immunology and Allergy Unit, Shaare Zedek Medical Center, ישראל

Background: CARMIL2 deficiency is characterized by reduced regulatory T cell (T_REGS) and impaired CD28-mediated T cell activation. Targeted therapy to CAMRIL2-deficient patients is currently unavailable.

Objective: To analyze the effect of interleukin (IL)-2 on T cell activation and proliferation in CARMIL-2-deficient patients.

Methods: Four CARMIL2-deficient children (one male) were studied. Diagnosis confirmation was accomplished by whole exome sequencing and immunoblotting. Immune analyses consisted of quantification of T cell subtypes and T_REGS using flow-cytometry. T cells were activated in-vitro using anti-CD3 and -CD28 with IL-2 in three doses (0, 80 and 400 U/mL). Activation markers including CD25 and interferon (IFN)-γ levels were measured and compared after 48 hours and 5 days of culture. T cell proliferation with different IL-2 doses was also measured using CellTrace-Violet.

Results: The patients presented with IBD, recurrent cytomegalovirus and human papilloma virus infections. Genetic analysis revealed a novel homozygous 25 bp deletion: c.A689del. GCCTTGAGGTCTCAGAACAGATTCT, p.S230del-fs*2. Immunoblot analysis demonstrated absence of CARMIL2 protein in all the patients, as compared to healthy controls. T_REGS were decreased in three patients. T cell activation and proliferation were impaired in all the patients. Rescue of T cell activation was noted in IL-2 dose of 400 U/mL but not in 80 U/mL. Rescue of T cell proliferation was seen in IL2 dose of 80 U/mL.

Conclusions: IL-2 can rescue in-vitro T cell activation and proliferation in CARMIL2-deficient patients. Intravenous IL-2 treatment should be further studied in murine models and clinical trials, as a possible therapeutic modality in these patients.